The EMBOSS Frequently Asked Questions list ========================================== Last modified: 9 Jan 2003 SECTION A - Help and Support ============================ Q) How do I report bugs ? A) mail emboss-bug@embnet.org Q) Are there any mailing lists about EMBOSS? A) emboss@embnet.org is an open list (anyone can join) for general announcements and discussions by end users. emboss-dev@embnet.org is a closed list for discussions by developers using EMBOSS. To subscribe to either list, send mail to majordomo@embnet.org with the message text subscribe emboss or subscribe emboss-dev Q) Where's the documentation? A) All the documentation can be found at the following web page http://www.uk.embnet.org/Software/EMBOSS/ Q) Where's the applications' documentation? A) http://www.uk.embnet.org/Software/EMBOSS/Apps/ Q) Is there a tutorial? A) Short tutorial: http://www.hgmp.mrc.ac.uk/Registered/Help/emboss/short_emboss_tutorial/ Long tutorial: http://www.hgmp.mrc.ac.uk/Registered/Help/emboss/ Q) Is there a quick guide? A) A revised version is now available incorporating many of the suggestions I have had. In order to get everything on I have shrunk the text to 9pt (sorry, no free magnifying glasses) and also prepared a postscript version. ftp://ftp.no.embnet.org/embnet/tutorials/EMBOSS_QG.ps (Postscript file) ftp://ftp.no.embnet.org/embnet/tutorials/EMBOSS_QG.doc (Word 97 format- Yuk!) Q) Is there a table of substitutes for GCG programs? A) http://www.no.embnet.org/FromGCG.html Q) Is there a reference I can cite for EMBOSS? A) Rice,P. Longden,I. and Bleasby,A. "EMBOSS: The European Molecular Biology Open Software Suite" Trends in Genetics June 2000, vol 16, No 6. pp.276-277 SECTION B - Installation & Compilation ====================================== Q) How do I compile EMBOSS? A) Make sure you have the latest code and if you have compiled before try the following:- rm config.cache (if that file exists) make clean ./configure make If this is the first time trying to compile all you need to do is:- ./configure make The above will produce the EMBOSS programs in the 'emboss' subdirectory and you can set your PATH variable to point there. This method is suitable for EMBOSS developers. For system-wide installations we recommend installing the EMBOSS programs into a different directory to the source code (e.g. in the directory tree /usr/local/emboss). To do this type [e.g.]: ./configure --prefix=/usr/local/emboss make [to make sure there are no errors, then] make install [if there are no errors] You should then add [e.g.] /usr/local/emboss/bin to your PATH variable [e.g.] set path=(/usr/local/emboss/bin $path) [csh/tcsh shells] export PATH="$PATH /usr/local/emboss/bin" [sh/bash shells] Q) I have an AMD64/Opteron/EM64T system. How do I prevent the compiled programs giving segmentation faults? A) Start with a fresh extraction of the EMBOSS source and, before configuring, type (for all the above systems): setenv CC "cc -D__amd64__" [csh/tcsh shells] or export CC="cc -D__amd64__" [bash/sh] Note that the above is case sensitive, there is only one space character between the quotes and that there are 4 underscores in total (two each side of the amd64). Q) I have a Linux system and compilation ends prematurely saying that it can't find the -lX11 libraries ... but I know I have X11 installed. A) You may well have the X11 server installed but you haven't installed the X11 development files. For example, on RPM distributions, you need to install: xorg-x11-devel (xorg-based X11 distros) or XFree86-devel (XFree86-based X11 distros) Q) I'm trying to compile EMBOSS with the PNG support A) If you have gd-1.7.3, zlib-1.1.3 and libpng-1.0.5 or greater then the normal configure/compile should work! However, due to gd no longer supporting gif format then you may need to install gd, zlib and libpng locally. You can unpack the tar.gz files in any directory, and install them in a common area. By default everything (including EMBOSS) installs in /usr/local but in the examples below we use /home/joe/local Note: gd does not use a ./configure script, and will fail at the "make install" stage if the installation directory does not have a /bin subdirectory. You can create this directory (e.g. /home/joe/local/bin) if it does not already exist. To install, pick up the sources (jpeg is optional) and then: gunzip -c zlib-1.1.4.tar.gz | tar xf - gunzip -c libpng-1.2.5.tar.gz | tar xf - gunzip -c jpegsrc.v6b.tar.gz | tar xf - gunzip -c gd-2.0.9.tar.gz | tar xf - ln -s zlib-1.1.4 zlib ln -s jpeg-6b jpeg ln -s libpng-1.2.5 libpng ln -s gd-2.0.9 gd If these directories do not exist, "make install" for jpeg will need them: mkdir /home/joe/local/bin mkdir /home/joe/local/man mkdir /home/joe/local/man/man1 cd zlib ./configure --prefix=/home/joe/local make make install cd .. cd jpeg ./configure --prefix=/home/joe/local make make test make install cd .. cd libpng ./configure --prefix=/home/joe/local But this says: There is no "configure" script for Libpng-1.2.5. Instead, please copy the appropriate makefile for your system from the "scripts" directory. Read the INSTALL file for more details. so copy the file, for example "cp scripts/makefile.linux makefile" ## ## edit makefile, change prefix to be /home/joe/local ## and any other places - some files point to ../zlib ## others use /usr/local/lib and /usr/local/include ## ## on HP-UX this is trickier. CFLAGS has to match zlib ## make make install cd .. cd gd ## ## for 1.x versions, edit Makefile, change: ## INCLUDEDIRS, LIBDIRS, INSTALL_LIB, INSTALL_INCLUDE, INSTALL_BIN ## all /usr/local ## to /home/joe/local ## ## for 2.x versions, we use ./configure (hurrah!) ./configure --prefix=/home/joe/local --with-png=/home/joe/local \ --with-jpeg=/home/joe/local make make install cd .. If the gd or jpeg "make install" fails with a warning about the "bin" "man" or "man/man1" directory, you need to create it by hand (see above). To compile with the local version your EMBOSS ./configure line should now read:- ./configure --with-pngdriver=/home/joe/local This will look for the graphics libraries in your local installation under /home/joe/local instead of a system-wide location configure keeps a copy of the previous settings. You may need to delete file config.cache and config.status if configure has been run before. Q) When installing EMBOSS recently I get a load of errors due to libraries not found. The main problem is that I have an old version of libz but no lib gd in my system libraries and EMBOSS looks there first to try to locate these libraries. I have the correct versions installed elsewhere. Deleting -lgd -lz -lpng from CFLAGS in the ajax directory Makefile works but is an ugly solution and not really ideal. Are there any suggestions for setting the library search path or am I missing something really obvious? A) There are the --without-pngdriver and --with-pngdriver=dir flags. Did you try them? If the libraries are in /opt/png/lib then set "dir" to /opt/png i.e. one level above the "lib" directory. Q) Can I get the latest code via CVS ? A) Yes. Here is the information you will need:- Make sure you have cvs on your system Then log into the cvs server at 'open-bio.org' as: user 'cvs' with password 'cvs'. cvs -d :pserver:cvs@cvs.open-bio.org:/home/repository/emboss login The password is 'cvs' To checkout the EMBOSS source code tree, put yourself in a local directory just above where you want to see the EMBOSS directory created. For example if you wanted EMBOSS to be seen as /home/joe/src/emboss... then cd into /home/joe/src then checkout the repository by typing: cvs -d :pserver:cvs@cvs.open-bio.org:/home/repository/emboss checkout emboss Or if you want to update a previously checked-out source code tree: cvs -d :pserver:cvs@cvs.open-bio.org:/home/repository/emboss update You can logout from the CVS server with: cvs -d :pserver:cvs@cvs.open-bio.org:/home/repository/emboss logout (this is a read only server). Q) How do i compile the CVS version? A) You will need automake, autoconf, gmake and libtool for this. The gcc compiler is recommended. The host cc compiler should work, but there is a problem with automake which generates the Makefiles. automake generates dependencies for you, in a '.deps' subdirectory, to keep Makefile.in clean, but since automake 1.4 this uses gcc. If you are not using gcc, you can use 'automake --include-deps' to put the dependencies into each Makefile.in file Scripts are available to compile the cvs version. i.e. source make-static-developers will compile a statically linked EMBOSS. What this actually does is:- aclocal -I m4 autoconf automake -a # --include-deps # if you are not using gcc ./configure --disable-shared make For more info on the configurability of the build try ./configure --help Q) Installing associated software MSE. A) a) from the anonymous cvs code. 1) Go to the mse directory cd embassy/mse 2) make the configuration file aclocal autoconf automake 3) configure and compile ./configure (use same options as you used to compile emboss) make make install b) from MSE-0.0.4.tar.gz available from our FTP server ftp://ftp.uk.embnet.org/pub/EMBOSS/ in file MSE-0.0.4.tar.gz If you have done a full installation of EMBOSS using a 'prefix' e.g. you configured with ./configure --prefix=/usr/local/emboss and followed this with a 'make install' then: 1) gunzip and untar the file anywhere gunzip MSE-0.0.4.tar.gz tar xvf MSE-0.0.4.tar 2) go into the mse directory cd MSE-0.0.4 3) configure using the same prefix and compile [e.g.]: ./configure --prefix=/usr/local/emboss make make install N.B. If you configured without using a prefix but did do a 'make install' (or specified a prefix of /usr/local, which amounts to the same thing) then you must configure using: ./configure --prefix=/usr/local --enable-localforce If, on the other hand, you did not do a 'make install' then: 1) Go to the emboss directory cd EMBOSS-2.10.0 2) make new directory embassy if it does not exist already. mkdir embassy 3) Go into that directory cd embassy 4) gunzip and untar the file gunzip MSE-0.0.4.tar.gz tar xvf MSE-0.0.4.tar 5) go into the mse directory cd MSE-0.0.4 6) configure and compile ./configure (use same options as you used to compile emboss) make make install Q) Installing associated software PHYLIP A) a) from the anonymous cvs code. 1) Go to the phylip directory cd embassy/phylip 2) make the configuration file aclocal autoconf automake 3) configure and compile ./configure (use same options as you used to compile emboss) make make install b) from PHYLIP-3.573c.tar.gz available from our FTP server ftp://ftp.uk.embnet.org/pub/EMBOSS/ in file PHYLIP-3.573c.tar.gz 1) Go to the emboss directory cd EMBOSS-0.0.4 2) make new directory embassy if it does not exist already. mkdir embassy 3) Go into that directory cd embassy 4) unzip and untar the file gunzip PHYLIP-3.573c.tar.gz tar xvf PHYLIP-3.573c.tar 5) go into the phylip directory cd PHYLIP-3.573c 6) configure and compile ./configure (use same options as you used to compile emboss) make make install Q) Problems finding PHYLIP acd files ? A) The 1.0 release of EMBOSS should be able to find the acd files in the install directory or in the original source directory. If you have copied the phylip binaries to another location and removed these files you can still point to the new ACD directory. If you have installed PHYLIP to the same top directory as EMBOSS i.e. by default this is usually /usr/local/ (via make install) then if you set the following in your .embossrc file then your PHYLIP acd files will be found in /usr/local/share/EMBOSS/acd/ if you have not installed PHYLIP then you will can set emboss_acdroot to the directory containing the acd files or copy them to the emboss/acd directory. To tell EMBOSS where to find the files, specify the full path of the ACD directory in your ~/.embossrc file, or in the emboss.default file. env emboss_acdroot /usr/local/share/EMBOSS/acd/ Q) What benefits do i gain from using the associated versions of software. A) a) You can read any sequence type that emboss can handle. b) the associated software will use the emboss acd files so the naming of output/input files is taken care of and will check all values before the program is run. Command line arguments are used instead interactive menu based ones. Q) I have Emboss installed on our development server and I'm preparing a dispatch which will send it out to about 20 remote sites. I ran the configure with the --prefix option to install to a private directory. I also collected all the data files (rebase, transfac etc.) to another directory and extracted the information from them with the relevant programs. My intention was to simply transfer the Emboss install directory and the Data directory to all sites, using symlinks where necessary so that the directory paths corresponded. However, when testing this I have found a couple of problems; 1) Although the Emboss programs work, I can't see any of the extracted data. For instance remap gives the error; EMBOSS An error in remap.c at line 167: Cannot locate enzyme file. Run REBASEEXTRACT This is despite the fact that I have both the Emboss install and the Data directories in the same place as on the development machine (which works). 2) The other major problem is that I can no longer see my databases defined in emboss.default. Again, the file exists, and is in the same place as on the development machine, but the box it is transferred to gives an empty list from showdb. Does anyone know where Emboss stores the information about the location of these files? It can't have installed anything outside the original installation directory (wasn't installed as root), so I'm guessing that the problem stems from the program resolving symlinks at some point. A) It is inside the binaries ... EMBOSS 'knows' the location of the files because it is picked up during the configure, when you build your copy, and included in the binaries. You can see it during compilation, especially of ajnam.c (where it is used): -DAJAX_FIXED_ROOT=\"/full/source/path\" -DPREFIX=\"/install/prefix/path\" To copy binaries, you need to define environment variable(s) to override the compile-time definitions, unless you can make the path (e.g. /usr/local) the same for the installations at each site. emboss.default can set environment variables too, but you need to tell EMBOSS where to find that file. setenv EMBOSS_ROOT /dir/for/default/file and then, in the emboss.default file you can set: SET EMBOSS_ACDROOT /install/dir/share/EMBOSS/acd or (this overrides it) you can use another environment variable: SET EMBOSS_ACDROOT /install/dir/share/EMBOSS/acd (Peter Rice 22 Nov 2000) Q) I have downloaded the Emboss source and installed it for use at XYZ University without any difficulty. The administration guide has advice on configuring the software using emboss.default, and has examples for allowing access to SRS indices. That appears to be done via the program getz, which is not part of the Emboss package. A) If you have SRS installed (so you have local SRS index files) you will have a local copy of the getz program, which is part of SRS. If you do not have SRS, you can build your own index files using dbiflat, dbigcg (if you have GCG), dbiblast (if you have blast) and dbifasta. This is the usual solution for sites that have no other database indexing in use. You can also use SRS servers remotely, to get single entries, using their URLs. No extra software is needed (EMBOSS just uses the HTTP protocol). Of course, if you really need to build your own SRS indices you could install it. SRS is a commercial product, but academic licences are available. But as I now work for the developers of SRS, and this is the EMBOSS bug mailing list, I shall say no more :-) (Peter Rice 9 Jan 2001) Q) I am not getting full static files even when I configure with --disable-shared A) This most often happens when using GNU LD. If both shared and static versions of a library exist then GNU LD will take the shared library as preferred. The root of this problem is libtool. You can, however, force complete static images by adding a definition to your "make" line: make "LDFLAGS=-Wl,-static" (Alan Bleasby 14 Feb 2001) SECTION C - Graphics ==================== Q) What Graphics options are available? A) To see what graphics drivers are available type ? at the promt for the graph type and this will give you a list. Here are some of those:- ps -> Postscript cps -> Colour Postscript x11 -> X display. (also called xterm and xwindows) hpgl -> HP Laserjet III, HPGL emulation mode. png -> PNG (you will need png, z and gd libraries for this) tek -> Tektronix Terminal none -> None. data -> Writes out points to a file for graphs. meta -> plplot meta file. Q) How do i get the PNG driver? A) To get the PNG driver you will need to have installed z,png and gd libraries. In particular gd version >= 1.7.3 must be used. If for some reason you do not have the required libraries and your system support group will not update these ( In particular gd, as the older versions support GIF which is NOT supported in later versions) then install all three latest versions (z,gd,png) to a new directory and then add this new directory to your configure line for EMBOSS. i.e. make clean rm config.cache ./configure --with-pngdriver=/home/joe/new as i installed gd etc using --prefix=/home/joe/new in the configure of each. If you have recently installed the libraries to your system then make clean rm config.cache ./configure By removing config.cache you are telling the system to check again for what is available as these are stored in that file. make clean removes all the current objects and EMBOSS libraries as these will now need to include the png driver code. Q) Where to look for the additional libraries needed for PNG. A) GD) http://www.boutell.com/gd/ Z) http://www.mirror.ac.uk/sites/ftp.cdrom.com/pub/infozip/zlib/ JPEG) http://www.ijg.org/ PNG) http://www.mirror.ac.uk/sites/ftp.libpng.org/pub/png/libpng.html These also list the various mirror sites for non UK people. Alternatively, using ftp :- GD) (boutell.com no longer allows FTP, no known mirror sites, use HTTP) Z) ftp://ftp.info-zip.org/pub/infozip/zlib/zlib-1.1.3.tar.gz JPEG) ftp://ftp.uu.net/graphics/jpeg/ PNG) ftp://swrinde.nde.swri.edu/pub/png/src/libpng.1.2.1.tar.gz Q) Plotters and pen colours. A) The hp drivers presume the pens are loaded as:- SP1 black SP2 white SP3 red SP4 green SP5 blue SP6 cyan SP7 magenta SP8 yellow Otherwise your output will have different colours. Q) Browsing the Gnu site I came across libplot, libxmi and plot utils. Would these be a suitable replacement for PLPLOT? A) So far they are still GPL rather than LGPL. Robert Maier promised a while back to LGPL them but has not yet. Pity. Makes all the difference for linking in third party applications to EMBOSS. Q) I am trying to compile PNG support into EMBOSS on our CTU Unix system. This requires the z, png and gd libraries, which are not on our system at the moment. Does anyone know where I can get these libraries for either OSF or CTU Unix? All the references to them I have found on the web have been for Linux. Are these platform independent (so I can use the Linux libraries)? Or do I need specific versions for our unix version? A) You should be able to compile them from the source on just about any Unix platform. http://www.info-zip.org/pub/infozip/zlib/ http://libpng.sourceforge.net/ http://www.boutell.com/gd/ Q) I get error messages when I try to display X11 on my PC. I am running the Hummingbird Exceed X11 emulator. A) The Hummingbird Exceed X11 emulator (and maybe other systems) use the 'TrueColor' display by default. You should change the configuration settings so that it uses 'PseudoColor'. In version 6.1 of Hummingbird Exceed, this is done by clicking on the Exceed section of the Windows 98 tool bar at the bottom of the screen. Select 'Tools', then 'Configuration', then Screen Definition. A window will appear. In the 'Server Visual' popup menu on the left, select 'PseudoColor'. Click on 'OK'. SECTION D - Data Files ====================== Q) How do I use my own private data file? A) You may wish to amend one of the standard EMBOSS data files. One of the data files you might wish to alter are the translation table files. 'transeq' has been written to only read in one of the standard translation files: EGC.0 EGC.1 EGC.2 EGC.3 EGC.4 EGC.5 EGC.6 EGC.9 EGC.10 EGC.12 EGC.11 EGC.13 EGC.14 EGC.15 These files are the only ones that you can specify to 'transeq'. If you wish to create your own specialised translation table, then you should pick one of them to amend. For instance you may decide that you will use the file EGC.15 as you would never want to use this otherwise. Use the program 'embossdata' to get a copy of this file: % embossdata -fetch -filename EGC.15 Finds or fetches the data files read in by the EMBOSS programs File '/packages/emboss/emboss/data/EGC.15' has been copied successfully. Edit the file EGC.15 to suit your requirements. Specify '-table 15' when you run 'transeq' to use this altered file. 'transeq' will then look for the file 'EGC.15' and will find it in your current directory before it finds the default one in the EMBOSS_DATA directory. It will therefore use your local copy. You may get confused with many copies of changed files floating about. To check which copy of a file is being used - the default EMBOSS_DATA one or a potential local copy, use 'embossdata': % embossdata -filename EGC.15 Finds or fetches the data files read in by the EMBOSS programs # The following directories can contain EMBOSS data files. # They are searched in the following order until the file is found. # If the directory does not exist, then this is noted below. # '.' is the UNIX name for your current working directory. File ./EGC.15 Exists File .embossdata/EGC.15 Does not exist File /people/gwilliam/EGC.15 Does not exist File /people/gwilliam/.embossdata/EGC.15 Does not exist File /packages/emboss/emboss/data/EGC.15 Exists This shows that a copy of EGC.15 exists in your current directory and so will be used in preference to the default one in the EMBOSS_DATA directory. SECTION E - Sequence Files and Formats ====================================== Q) How do you write sequences to different files instead of writing them all to one file? A) EMBOSS is not good at writing multiple sequences to different files. You could try using 'nthseq' to pull out one sequence at a time. You should consider using the '-ossingle' qualifier. This writes sequences to separate FASTA files, but the file names depend on the sequence ID. This is rarely used. It is there because -ossingle is the default for GCG output format. The output filename is currently ignored when ossingle is used, and the filename depends on each individual sequence. Q) What sequence formats are supported? A) Many: gcg, embl, swissprot, fasta, ncbi, genbank, nbrf, codata, strider, clustal, phylip, acedb, msf, ig, staden, text, raw, asis Q) What is the difference between TEXT and RAW formats? A) TEXT accepts everything in the sequence file as sequence. RAW accepts only alphanumeric and whitespace characters and rejects anything else. Q) What is ASIS format? A) The "filename" is really the sequence. This is a quick and easy way of reading in a short fragment of sequence without having to enter it into a file. For example: % program -seq asis::ATGGTGAGGAGAGTTGTGATGAGA Q) I have some very short protein sequences that EMBOSS thinks are nucleic sequences. How do I force EMBOSS to treat them as nucleic acid sequences? For example: > cat seq1 A > cat seq2 I % water seq1 seq2 -stdout -auto Smith-Waterman local alignment. An error has been found: Sequence is not nucleic Here, 'water' automatically (and wrongly) thinks that A is adenosine instead of alanine and fails when it reads in seq2 and expects to find another nucleic acid sequence - but 'I' is not a valid base and so it fails. A) For many sequence formats there is no way to specify the sequence type in the file, so EMBOSS has to guess. There is a flag that can force EMBOSS programs to treat sequences as nucleic or protein. 'water -help -verbose' shows the full list of sequence qualifiers. If you follow the sequence USA with '-sprotein' EMBOSS will check that it is a valid protein sequence. If you need to force a sequence to be DNA, the qualifier is '-snucleotide' The qualifier must follow the sequence to apply to one sequence, or can go at the start of the command line to refer to all sequences, for example: 'water -sprotein seq4 seq3 -stdout -auto' You can also use '-sprotein1' anywhere on the command line to refer to the first sequence and '-sprotein2' to refer to the second sequence. Of course, like all EMBOSS qualifiers, you can shorten them so long as they are still unique. In this case, '-sp' and '-sn' will work (or '-sp1' and '-sp2' if you need the numbers). SECTION F - Limits and contraints ================================= Q) Is there a maximum size for sequences? A) The maximum size for any program depends only on how much memory your system has. Of course, some programs (and some program options) can take up too much memory, or simply run very slowly. You might have a constraint imposed on your usage of memory. Try using the Unix command 'limit' to look at such constraints. Try using the Unix command 'unlimit' to remove the constraints, eg: % unlimit stacksize % unlimit vmemoryuse Q) GCG has a somewhat arbitrary fragment length limit of 2500 bp for gel*. Is there a similar limit for MSE under EMBOSS? A) No. MSE has no limit, you are only limited by how much memory you have. SECTION G - Running under Web servers and from scripts ====================================================== Q) I am trying to write a web interface for an emboss program and run apache. The program complains that there is no HOME directory set. A) Just put these at the top after your 'use CGI' ( whatever) statements. $ENV{HOME}= i.e. /usr/local/apache $ENV{EMBOSS_DATA}= These two are important, but you can also pass other "constants". SECTION H - Programs and options ================================ Q) Plotting with pepwheel gives interesting output. pepwheel -turns=8 -send=30 sw:p77837 -auto gives a helical wheel plot but the residues are plotted so every two circles are sat on top of one another. A) That is the correct answer. Instead of 3.6 residues per turn, (5 turns in 18 steps) you seem to have a helix with 8 turns in 18 steps (4 in 9). Try -turns=4 -steps=9 ... but only if you are sure that is the way your helix goes. I suppose we could play with checking for common factors in pepwheel, but I don't know of any biologically meaningful setting that would cause problems. Q) In prettyplot, How do you specify an output file name for the plot file? A) prettyplot -auto ~/wordtest/globin-nogap.msf -graph ps Creates prettyplot.ps The name is generated automatically. To set this to something more discriptive use -go .i.e prettyplot -auto ~/wordtest/globin-nogap.msf -graph ps -go=hello Creates hello.ps Q) In the editor 'mse', but I don't know how to save my edited sequences at the end of the editing session. A) Use Control-Z to get into command mode. Then use the SAVE command which will prompt for the file name. Q) I would like to know if EMBOSS can perform nucleotide contig assembly similar to the function that GCG gelproject/gelview has. And if yes, is there any size restriction on the number of basepair and the number of contigs? thank you. A) EMBOSS does not cover the sort of contig assembly you describe. We leave that as the province of the Staden package from the LMB in Cambridge (down the road). Rodger Stadens group is developing a GUI (Spin) which uses both EMBOSS and his gel assembly programs. (29 Jan 2001)